Stem-loop sequence hsa-mir-3922

AccessionMI0016429 (change log)
Symbol HGNC:MIR3922
DescriptionHomo sapiens miR-3922 stem-loop
Literature search

1 open access papers mention hsa-mir-3922
(29 sentences)

Stem-loop
                                    cagg   g 
5' ggaagagucaagucaaggccagaggucccacag    gcu g
   |||||||||||||||||||||||||||||||||    |||  
3' cuuucucaguucaguuccggucuucaggguguc    cga a
                                    caca   a 
Get sequence
Deep sequencing
190 reads, 0 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 104591633-104591716 [+]
intergenic
Database links

Mature sequence hsa-miR-3922-5p

Accession MIMAT0019227
Sequence

13 - 

ucaaggccagaggucccacagca

 - 35

Get sequence
Deep sequencing17 reads, 11 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3922-3p

Accession MIMAT0018197
Previous IDshsa-miR-3922
Sequence

62 - 

ucuggccuugacuugacucuuu

 - 83

Get sequence
Deep sequencing44 reads, 32 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).