Stem-loop sequence hsa-mir-3921

AccessionMI0016428 (change log)
Symbol HGNC:MIR3921
DescriptionHomo sapiens miR-3921 stem-loop
Stem-loop
                                 a         aa 
5' ccuagcccaguacaaggcauaugguacuca gagacuuag  a
   |||||||||||||||||||||||||||||| |||||||||   
3' ggaucgggucauguuccguauaccaugagu cucugaauc  u
                                 -         cc 
Get sequence
Deep sequencing
653 reads, 4.76 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 99964314-99964398 [-]
intergenic
Database links

Mature sequence hsa-miR-3921

Accession MIMAT0018196
Sequence

52 - 

ucucugaguaccauaugccuugu

 - 74

Get sequence
Deep sequencing20 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).