Stem-loop sequence hsa-mir-3920

AccessionMI0016427 (change log)
Symbol HGNC:MIR3920
DescriptionHomo sapiens miR-3920 stem-loop
Stem-loop
               a               g           gu 
5' acugagugaggg gucagagaguuaaga aauuaguacag  g
   |||||||||||| ||||||||||||||| |||||||||||   
3' ugacucacuccc cagucucucaauucu uuagucauguu  a
               c               a           ag 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 101519820-101519905 [-]
sense
OTTHUMT00000394832 ; TRPC6-007; intron 1
ENST00000526713 ; TRPC6-007; intron 1
Database links

Mature sequence hsa-miR-3920

Accession MIMAT0018195
Sequence

51 - 

acugauuaucuuaacucucuga

 - 72

Get sequence
Deep sequencing48 reads, 32 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).