Stem-loop sequence hsa-mir-3919

AccessionMI0016425 (change log)
Symbol HGNC:MIR3919
DescriptionHomo sapiens miR-3919 stem-loop
Literature search

2 open access papers mention hsa-mir-3919
(4 sentences)

Stem-loop
                                    a   - uu gu 
5' ccugagcaccauuuacugaguccuuuguucucu cua g  u  a
   ||||||||||||||||||||||||||||||||| ||| |  |   
3' ggacucgugguaaaugacucaggaaacaagaga gau c  g  g
                                    c   g uu au 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 159282646-159282734 [+]
sense
OTTHUMT00000352557 ; IQCJ-SCHIP1-008; intron 1
OTTHUMT00000352559 ; IQCJ-SCHIP1-010; intron 1
OTTHUMT00000352563 ; IQCJ-SCHIP1-007; intron 1
OTTHUMT00000352552 ; IQCJ-SCHIP1-006; intron 3
OTTHUMT00000368859 ; IQCJ-SCHIP1-002; intron 3
OTTHUMT00000368861 ; IQCJ-SCHIP1-004; intron 3
OTTHUMT00000352451 ; IQCJ-SCHIP1-009; intron 4
OTTHUMT00000368858 ; IQCJ-SCHIP1-001; intron 4
OTTHUMT00000368860 ; IQCJ-SCHIP1-003; intron 4
OTTHUMT00000368862 ; IQCJ-SCHIP1-005; intron 4
ENST00000337808 ; IQCJ-SCHIP1-008; intron 1
ENST00000412423 ; IQCJ-SCHIP1-010; intron 1
ENST00000527095 ; IQCJ-SCHIP1-007; intron 1
ENST00000467442 ; IQCJ-SCHIP1-006; intron 3
ENST00000476809 ; IQCJ-SCHIP1-002; intron 3
ENST00000481715 ; IQCJ-SCHIP1-004; intron 3
ENST00000471575 ; IQCJ-SCHIP1-009; intron 4
ENST00000485419 ; IQCJ-SCHIP1-001; intron 4
ENST00000483486 ; IQCJ-SCHIP1-003; intron 4
ENST00000488898 ; IQCJ-SCHIP1-005; intron 4
Database links

Mature sequence hsa-miR-3919

Accession MIMAT0018193
Sequence

55 - 

gcagagaacaaaggacucagu

 - 75

Get sequence
Deep sequencing32 reads, 21 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).