Stem-loop sequence hsa-mir-3918

AccessionMI0016424 (change log)
Symbol HGNC:MIR3918
DescriptionHomo sapiens miR-3918 stem-loop
Literature search

1 open access papers mention hsa-mir-3918
(1 sentences)

Stem-loop
      c     --a    u  ga     -  g   a        g  caa 
5' agg gguua   gcca gg  caggg cc cag uggagacu cu   g
   ||| |||||   |||| ||  ||||| || ||| |||||||| ||   g
3' ucc ccgau   uggu cc  guccc gg guc accucugg ga   u
      -     gcu    -  ac     a  -   g        g  aac 
Get sequence
Deep sequencing
134 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 158764661-158764753 [-]
antisense
OTTHUMT00000042870 ; TULP4-002; intron 1
OTTHUMT00000042869 ; TULP4-001; intron 1
ENST00000367094 ; TULP4-002; intron 1
ENST00000367097 ; TULP4-001; intron 1
Database links

Mature sequence hsa-miR-3918

Accession MIMAT0018192
Sequence

19 - 

acagggccgcagauggagacu

 - 39

Get sequence
Deep sequencing116 reads, 20 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).