Stem-loop sequence hsa-mir-3917

AccessionMI0016423 (change log)
Symbol HGNC:MIR3917
DescriptionHomo sapiens miR-3917 stem-loop
Stem-loop
    g       -g  c  g    g   ug  gg       ag  u    a 
5' g cgcuuuu  ug gc cccg guc  uu  ugcucag  ug gguc g
   | |||||||  || || |||| |||  ||  |||||||  || ||||  
3' c gcggagg  gc cg gggc ugg  gg  acgaguc  gc ucgg g
    g       ag  u  -    g   gu  --       ag  -    c 
Get sequence
Deep sequencing
397 reads, 3.66 reads per million, 82 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 25906362-25906454 [-]
intergenic
Database links

Mature sequence hsa-miR-3917

Accession MIMAT0018191
Sequence

52 - 

gcucggacugagcagguggg

 - 71

Get sequence
Deep sequencing319 reads, 67 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).