Stem-loop sequence hsa-mir-3916

AccessionMI0016422 (change log)
Symbol HGNC:MIR3916
DescriptionHomo sapiens miR-3916 stem-loop
Literature search

1 open access papers mention hsa-mir-3916
(1 sentences)

Stem-loop
           gaagaa      a     a  a   ---g    uu     gu a 
5' aucccaga      ggaaga gagga ga aug    cugg  cucag  g a
   ||||||||      |||||| ||||| || |||    ||||  |||||  |  
3' uagggucu      ucuuuu cuccu cu ugu    gacu  ggguc  u u
           ------      -     -  g   aggg    -u     ug g 
Get sequence
Deep sequencing
745 reads, 14 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 247201967-247202060 [-]
sense
OTTHUMT00000380864 ; ZNF670-002; intron 1
OTTHUMT00000380865 ; ZNF670-003; intron 1
OTTHUMT00000098183 ; ZNF670-001; intron 3
ENST00000465049 ; ZNF670-002; intron 1
ENST00000474541 ; ZNF670-003; intron 1
ENST00000366503 ; ZNF670-001; intron 3
Database links

Mature sequence hsa-miR-3916

Accession MIMAT0018190
Sequence

20 - 

aagaggaagaaauggcugguucucag

 - 45

Get sequence
Deep sequencing532 reads, 91 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).