Stem-loop sequence hsa-mir-3915

AccessionMI0016420 (change log)
Symbol HGNC:MIR3915
DescriptionHomo sapiens miR-3915 stem-loop
Stem-loop
   -c   u      ug                a             c  a 
5'   aag uggcac  uagaauauugaggaaa gauggucuuauug aa g
     ||| ||||||  |||||||||||||||| ||||||||||||| ||  
3'   uuc acugug  gucuuauaacuccuuu cuaccagaauaac uu a
   gu   u      gu                c             u  u 
Get sequence
Deep sequencing
80 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 32583656-32583752 [-]
sense
OTTHUMT00000056184 ; DMD-003; intron 2
OTTHUMT00000056185 ; DMD-004; intron 2
OTTHUMT00000056186 ; DMD-005; intron 2
OTTHUMT00000056187 ; DMD-006; intron 16
OTTHUMT00000056182 ; DMD-001; intron 16
OTTHUMT00000056183 ; DMD-002; intron 16
ENST00000488902 ; DMD-003; intron 2
ENST00000420596 ; DMD-004; intron 2
ENST00000448370 ; DMD-005; intron 2
ENST00000378677 ; DMD-006; intron 16
ENST00000357033 ; DMD-001; intron 16
ENST00000288447 ; DMD-002; intron 16
Database links

Mature sequence hsa-miR-3915

Accession MIMAT0018189
Sequence

21 - 

uugaggaaaagauggucuuauu

 - 42

Get sequence
Deep sequencing59 reads, 27 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).