Stem-loop sequence hsa-mir-3912

AccessionMI0016416 (change log)
Symbol HGNC:MIR3912
DescriptionHomo sapiens miR-3912 stem-loop
Gene family MIPF0001601; mir-3912
Literature search

1 open access papers mention hsa-mir-3912
(9 sentences)

Stem-loop
           auga                              g      u   g 
5' agagagga    acaguuaaauuauaacauguccauauuaug guuagu gug a
   ||||||||    |||||||||||||||||||||||||||||| |||||| |||  
3' ucuuuccu    ugucaauuuaauauuguacagguauaauac caauca uac c
           ----                              g      -   a 
Get sequence
Deep sequencing
2392 reads, 0 reads per million, 130 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 171386656-171386760 [-]
sense
OTTHUMT00000372381 ; FBXW11-001; intron 1
OTTHUMT00000372382 ; FBXW11-002; intron 1
OTTHUMT00000372383 ; FBXW11-003; intron 1
OTTHUMT00000372387 ; FBXW11-007; intron 1
OTTHUMT00000372388 ; FBXW11-008; intron 1
OTTHUMT00000372384 ; FBXW11-004; intron 2
OTTHUMT00000372385 ; FBXW11-005; intron 2
OTTHUMT00000372386 ; FBXW11-006; intron 2
OTTHUMT00000372391 ; FBXW11-011; intron 2
ENST00000296933 ; FBXW11-001; intron 1
ENST00000265094 ; FBXW11-002; intron 1
ENST00000393802 ; FBXW11-003; intron 1
ENST00000517395 ; FBXW11-007; intron 1
ENST00000518752 ; FBXW11-008; intron 1
ENST00000425623 ; FBXW11-201; intron 1
ENST00000523843 ; FBXW11-004; intron 2
ENST00000519693 ; FBXW11-005; intron 2
ENST00000520376 ; FBXW11-006; intron 2
ENST00000522507 ; FBXW11-011; intron 2
Database links

Mature sequence hsa-miR-3912-5p

Accession MIMAT0027036
Sequence

29 - 

auguccauauuauggguuagu

 - 49

Get sequence
Deep sequencing106 reads, 34 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3912-3p

Accession MIMAT0018186
Sequence

63 - 

uaacgcauaauauggacaugu

 - 83

Get sequence
Deep sequencing2253 reads, 126 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).