Stem-loop sequence hsa-mir-3910-1

AccessionMI0016414 (change log)
Symbol HGNC:MIR3910-1
DescriptionHomo sapiens miR-3910-1 stem-loop
Gene family MIPF0001148; mir-3910
Literature search

3 open access papers mention hsa-mir-3910-1
(3 sentences)

         cu          ---c                              auca 
5' cuuuug  gucaguuuuu    uguugcuugucuugguuuuaugccuuuuau    a
   ||||||  ||||||||||    ||||||||||||||||||||||||||||||     
3' gaagac  uaguuaggaa    acaacgaacagaaccaaaauacggaaaaua    g
         ac          aaaa                              cacg 
Get sequence
Deep sequencing
483 reads, 2.3 reads per million, 87 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 91636251-91636361 [+]
OTTHUMT00000052986 ; SHC3-001; intron 11
ENST00000375835 ; SHC3-001; intron 11
Clustered miRNAs
< 10kb from hsa-mir-3910-1
hsa-mir-3910-1chr9: 91636251-91636361 [+]
hsa-mir-3910-2chr9: 91636264-91636345 [-]
Database links

Mature sequence hsa-miR-3910

Accession MIMAT0018184

63 - 


 - 82

Get sequence
Deep sequencing932 reads, 84 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets


PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).