Stem-loop sequence hsa-mir-3909

AccessionMI0016413 (change log)
Symbol HGNC:MIR3909
DescriptionHomo sapiens miR-3909 stem-loop
Literature search

1 open access papers mention hsa-mir-3909
(1 sentences)

Stem-loop
      aug   u    c    -  -    c     -a        cg         gaaaagc 
5' ggu   cug ugcg uguc cu uccu ugggg  gcaggcuc  ggggacagg       a
   |||   ||| |||| |||| || |||| |||||  ||||||||  |||||||||       c
3' cca   gac acgu acag ga aggg acucu  cguccggg  cuccuguuc       a
      --g   c    -    u  g    u     ga        au         aaggaac 
Get sequence
Deep sequencing
2057 reads, 0.763 reads per million, 131 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 35335640-35335758 [+]
antisense
OTTHUMT00000467276 ; RP1-272J12.1-003; intron 8
ENST00000448318 ; RP1-272J12.1-003; intron 8
Clustered miRNAs
< 10kb from hsa-mir-3909
hsa-mir-3909chr22: 35335640-35335758 [+]
hsa-mir-6069chr22: 35336721-35336799 [-]
Database links

Mature sequence hsa-miR-3909

Accession MIMAT0018183
Sequence

71 - 

uguccucuagggccugcagucu

 - 92

Get sequence
Deep sequencing1873 reads, 125 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2