Stem-loop sequence hsa-mir-3908

AccessionMI0016412 (change log)
Symbol HGNC:MIR3908
DescriptionHomo sapiens miR-3908 stem-loop
Literature search

1 open access papers mention hsa-mir-3908
(80 sentences)

Stem-loop
        a  a  gu   u     --             ---u         --   -aa   -    u 
5' gccug gc au  agg agacu  guuucuaaaaaaa    aaaaaguua  aaa   auu uaug u
   ||||| || ||  ||| |||||  |||||||||||||    |||||||||  |||   ||| ||||  
3' cggac cg ug  ucc ucuga  cagagguuuuuuu    uuuuuuaau  uuu   uaa gugc a
        -  c  uc   c     ga             uuuu         ca   gug   u    a 
Get sequence
Deep sequencing
1953 reads, 72.1 reads per million, 147 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 123536409-123536534 [+]
antisense
OTTHUMT00000401341 ; PITPNM2-001; intron 1
OTTHUMT00000401344 ; PITPNM2-003; intron 1
OTTHUMT00000401345 ; PITPNM2-002; intron 1
OTTHUMT00000401347 ; PITPNM2-008; intron 1
OTTHUMT00000401348 ; PITPNM2-006; intron 1
OTTHUMT00000401346 ; PITPNM2-007; intron 2
ENST00000280562 ; PITPNM2-001; intron 1
ENST00000546049 ; PITPNM2-003; intron 1
ENST00000451868 ; PITPNM2-002; intron 1
ENST00000535289 ; PITPNM2-008; intron 1
ENST00000541244 ; PITPNM2-006; intron 1
ENST00000320201 ; PITPNM2-201; intron 1
ENST00000392428 ; PITPNM2-202; intron 1
ENST00000542210 ; PITPNM2-007; intron 2
Database links

Mature sequence hsa-miR-3908

Accession MIMAT0018182
Sequence

5 - 

gagcaauguagguagacuguuu

 - 26

Get sequence
Deep sequencing25 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).