Stem-loop sequence hsa-mir-3907

AccessionMI0016410 (change log)
Symbol HGNC:MIR3907
DescriptionHomo sapiens miR-3907 stem-loop
Literature search

1 open access papers mention hsa-mir-3907
(1 sentences)

Stem-loop
          aaa   gu   ugu       cau   uacg     cau       -   u    g     c ag      cc  ag 
5' ggguugg   gcu  agg   ggagggg   gga    ggggc   gagggug ggg ccag cugga c  gccugc  ug  u
   |||||||   |||  |||   |||||||   |||    |||||   ||||||| ||| |||| ||||| |  ||||||  ||  c
3' cccaacc   cgg  ucc   ccuucuc   ucu    cuccg   cucccac cuc gguc gaccu g  uggacg  ac  c
          --c   --   -uu       ---   ----     --u       a   -    g     c --      --  cc 
Get sequence
Deep sequencing
340 reads, 36.6 reads per million, 82 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 151433489-151433639 [-]
sense
OTTHUMT00000348440 ; PRKAG2-001; intron 3
OTTHUMT00000348442 ; PRKAG2-003; intron 3
OTTHUMT00000348445 ; PRKAG2-006; intron 3
OTTHUMT00000348444 ; PRKAG2-005; intron 3
OTTHUMT00000348447 ; PRKAG2-008; intron 3
ENST00000287878 ; PRKAG2-001; intron 3
ENST00000392801 ; PRKAG2-003; intron 3
ENST00000488258 ; PRKAG2-006; intron 3
ENST00000481434 ; PRKAG2-005; intron 3
ENST00000461529 ; PRKAG2-008; intron 3
Database links

Mature sequence hsa-miR-3907

Accession MIMAT0018179
Sequence

93 - 

aggugcuccaggcuggcucaca

 - 114

Get sequence
Deep sequencing16 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).