Stem-loop sequence hsa-mir-384

AccessionMI0001145 (change log)
Symbol HGNC:MIR384
DescriptionHomo sapiens miR-384 stem-loop
Gene family MIPF0000289; mir-384
Literature search

18 open access papers mention hsa-mir-384
(132 sentences)

Stem-loop
   u    aau    a   uua       c   -----   aa    uau 
5'  guua   cagg auu   aacaauu cua     gac  uaug   a
    ||||   |||| |||   ||||||| |||     |||  ||||   a
3'  caau   gucc uaa   uuguuaa gau     cug  auac   u
   a    ---    g   uac       a   ccuua   -a    uug 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 76919273-76919360 [-]
sense
OTTHUMT00000058861 ; ATRX-002; intron 10
OTTHUMT00000058860 ; ATRX-001; intron 11
OTTHUMT00000058862 ; ATRX-003; intron 12
ENST00000395603 ; ATRX-002; intron 10
ENST00000373344 ; ATRX-001; intron 11
ENST00000480283 ; ATRX-003; intron 12
Database links

Mature sequence hsa-miR-384

Accession MIMAT0001075
Sequence

57 - 

auuccuagaaauuguucaua

 - 76

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence by similarity; MI0001146
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).