Stem-loop sequence hsa-mir-378g

AccessionMI0016761 (change log)
Symbol HGNC:MIR378G
DescriptionHomo sapiens miR-378g stem-loop
Literature search

191 open access papers mention hsa-mir-378g
(903 sentences)

Stem-loop
   -ca       u        a 
5'    cugggcu ggagucag a
      ||||||| |||||||| g
3'    gacccga ccucgguc a
   cuc       -        c 
Get sequence
Deep sequencing
5264901 reads, 4.64e+03 reads per million, 159 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-378g

Accession MIMAT0018937
Sequence

2 - 

acugggcuuggagucagaag

 - 21

Get sequence
Deep sequencing5264897 reads, 159 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).