Stem-loop sequence hsa-mir-378f

AccessionMI0016756 (change log)
Symbol HGNC:MIR378F
DescriptionHomo sapiens miR-378f stem-loop
Literature search

189 open access papers mention hsa-mir-378f
(902 sentences)

Stem-loop
   g     u --    a    cau    uu   -   gcuaaac 
5'  ucagg c  cugg cucc   aguu  cag gcu       a
    ||||| |  |||| ||||   ||||  ||| |||        
3'  gguuc g  gacc gagg   ucag  guc cga       a
   g     u aa    -    --u    --   a   gcaagac 
Get sequence
Deep sequencing
5406862 reads, 4.76e+03 reads per million, 158 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 23929070-23929147 [+]
sense
OTTHUMT00000008173 ; MDS2-002; intron 2
ENST00000477916 ; MDS2-002; intron 2
Database links

Mature sequence hsa-miR-378f

Accession MIMAT0018932
Sequence

52 - 

acuggacuuggagccagaag

 - 71

Get sequence
Deep sequencing5406857 reads, 158 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).