Stem-loop sequence hsa-mir-371b

AccessionMI0017393 (change log)
Symbol HGNC:MIR371B
DescriptionHomo sapiens miR-371b stem-loop
Gene family MIPF0000068; mir-290
Literature search

78 open access papers mention hsa-mir-371b
(511 sentences)

Stem-loop
   gguaa        aga   c         acca 
5'      cacucaaa   ugg ggcacuuuc    g
        ||||||||   ||| |||||||||    a
3'      gugaguuu   acc ccgugaaag    g
   ---cc        gac   c         acga 
Get sequence
Deep sequencing
23 reads, 23.5 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53787677-53787742 [-]
antisense
OTTHUMT00000464289 ; FAM90A27P-001; exon 4
ENST00000593323 ; FAM90A27P-001; exon 4
ENST00000338885 ; FAM90A27P-201; exon 4
Clustered miRNAs
< 10kb from hsa-mir-371b
hsa-mir-373chr19: 53788705-53788773 [+]
hsa-mir-372chr19: 53787890-53787956 [+]
hsa-mir-371bchr19: 53787677-53787742 [-]
hsa-mir-371achr19: 53787675-53787741 [+]
Database links

Mature sequence hsa-miR-371b-5p

Accession MIMAT0019892
Sequence

7 - 

acucaaaagauggcggcacuuu

 - 28

Get sequence
Deep sequencing18 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-371b-3p

Accession MIMAT0019893
Sequence

43 - 

aagugcccccacaguuugagugc

 - 65

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).