Stem-loop sequence hsa-mir-3714

AccessionMI0016135 (change log)
Symbol HGNC:MIR3714
DescriptionHomo sapiens miR-3714 stem-loop
Stem-loop
   --gaa      a   -  c      gac   cu 
5'      ggcagc gug cu cccugu   gug  c
        |||||| ||| || ||||||   |||   
3'      ccgucg cac ga gggacg   cac  c
   cucca      c   a  a      ggc   ua 
Get sequence
Deep sequencing
3022 reads, 5.26 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 16933196-16933260 [+]
sense
OTTHUMT00000340249 ; PLCL2-001; intron 1
OTTHUMT00000340250 ; PLCL2-002; intron 1
ENST00000460467 ; PLCL2-001; intron 1
ENST00000418129 ; PLCL2-002; intron 1
ENST00000396755 ; PLCL2-201; intron 1
Database links

Mature sequence hsa-miR-3714

Accession MIMAT0018165
Sequence

1 - 

gaaggcagcagugcuccccugu

 - 22

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20466808 "Deep sequencing reveals differential expression of microRNAs in favorable versus unfavorable neuroblastoma" Schulte JH, Marschall T, Martin M, Rosenstiel P, Mestdagh P, Schlierf S, Thor T, Vandesompele J, Eggert A, Schreiber S, Rahmann S, Schramm A Nucleic Acids Res. 38:5919-5928(2010).