Stem-loop sequence hsa-mir-3692

AccessionMI0016093 (change log)
Symbol HGNC:MIR3692
DescriptionHomo sapiens miR-3692 stem-loop
Stem-loop
        c    -ug     ga     u    gag a 
5' ccauu cugc   gucag  gugga acug   c a
   ||||| ||||   |||||  ||||| ||||   |  
3' gguga gacg   caguc  caccu ugac   g u
        a    uca     -a     -    aua a 
Get sequence
Deep sequencing
70 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 157529132-157529200 [+]
sense
OTTHUMT00000372723 ; ARID1B-009; exon 19
OTTHUMT00000042831 ; ARID1B-005; exon 19
OTTHUMT00000042827 ; ARID1B-001; exon 20
ENST00000350026 ; ARID1B-009; exon 19
ENST00000414678 ; ARID1B-005; exon 19
ENST00000346085 ; ARID1B-001; exon 20
ENST00000367148 ; ARID1B-202; exon 20
ENST00000275248 ; ARID1B-201; exon 20
Database links

Mature sequence hsa-miR-3692-5p

Accession MIMAT0018121
Previous IDshsa-miR-3692*
Sequence

6 - 

ccugcuggucaggaguggauacug

 - 29

Get sequence
Deep sequencing33 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-3692-3p

Accession MIMAT0018122
Previous IDshsa-miR-3692
Sequence

44 - 

guuccacacugacacugcagaagu

 - 67

Get sequence
Deep sequencing36 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).