Stem-loop sequence hsa-mir-3689f

AccessionMI0016837 (change log)
Symbol HGNC:MIR3689F
DescriptionHomo sapiens miR-3689f stem-loop
Gene family MIPF0001144; mir-3689
Stem-loop
   a      au    ug     ug   c ug ga 
5'  ggugug  aucg  cuucc  gga g  u  u
    ||||||  ||||  |||||  ||| |  |   
3'  ucacac  uagu  ggagg  ccu c  g  g
   c      cc    gu     gu   u gu uc 
Get sequence
Deep sequencing
50 reads, 25 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 134850742-134850807 [-]
sense
OTTHUMT00000054771 ; MED27-002; intron 3
OTTHUMT00000054770 ; MED27-001; intron 3
ENST00000357028 ; MED27-002; intron 3
ENST00000292035 ; MED27-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-3689f
hsa-mir-3689fchr9: 134850742-134850807 [-]
hsa-mir-3689echr9: 134850570-134850641 [-]
hsa-mir-3689d-2chr9: 134850277-134850356 [-]
hsa-mir-3689bchr9: 134850125-134850272 [-]
hsa-mir-3689d-1chr9: 134849609-134849682 [-]
hsa-mir-3689achr9: 134849487-134849564 [-]
hsa-mir-3689cchr9: 134849298-134849369 [-]
Database links

Mature sequence hsa-miR-3689f

Accession MIMAT0019010
Sequence

4 - 

ugugauaucgugcuuccuggga

 - 25

Get sequence
Deep sequencing37 reads, 7 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).