Stem-loop sequence hsa-mir-3689c

AccessionMI0016832 (change log)
Symbol HGNC:MIR3689C
DescriptionHomo sapiens miR-3689c stem-loop
Gene family MIPF0001144; mir-3689
Literature search

2 open access papers mention hsa-mir-3689c
(2 sentences)

Stem-loop
        g  ug     gu g    ug    g gu a 
5' gggag ug  auauc  g uucc  ggag u  g u
   ||||| ||  |||||  | ||||  |||| |  |  
3' uccuu gu  uauag  u gagg  ccuu g  c a
        g  gu     ug g    gu    g ug u 
Get sequence
Deep sequencing
142 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 134849298-134849369 [-]
sense
OTTHUMT00000054771 ; MED27-002; intron 3
OTTHUMT00000054770 ; MED27-001; intron 3
ENST00000357028 ; MED27-002; intron 3
ENST00000292035 ; MED27-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-3689c
hsa-mir-3689fchr9: 134850742-134850807 [-]
hsa-mir-3689echr9: 134850570-134850641 [-]
hsa-mir-3689d-2chr9: 134850277-134850356 [-]
hsa-mir-3689bchr9: 134850125-134850272 [-]
hsa-mir-3689d-1chr9: 134849609-134849682 [-]
hsa-mir-3689achr9: 134849487-134849564 [-]
hsa-mir-3689cchr9: 134849298-134849369 [-]
Database links

Mature sequence hsa-miR-3689c

Accession MIMAT0019007
Sequence

47 - 

cugggaggugugauauuguggu

 - 68

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).