Stem-loop sequence hsa-mir-3688-1

AccessionMI0016089 (change log)
Previous IDshsa-mir-3688
Symbol HGNC:MIR3688-1
DescriptionHomo sapiens miR-3688-1 stem-loop
Gene family MIPF0001263; mir-3688
Stem-loop
             c                          au   ugua 
5' ucuucacuuu aagaguggcaaagucuuuccauaugu  gua    u
   |||||||||| ||||||||||||||||||||||||||  |||    g
3' agaagugaaa uucucaccguuucagaaagguauaca  cau    u
             u                          --   uguc 
Get sequence
Deep sequencing
311 reads, 73.2 reads per million, 97 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 159128802-159128894 [-]
antisense
OTTHUMT00000365605 ; TMEM144-008; intron 2
OTTHUMT00000365604 ; TMEM144-007; intron 2
OTTHUMT00000365603 ; TMEM144-006; intron 2
ENST00000505049 ; TMEM144-008; intron 2
ENST00000505189 ; TMEM144-007; intron 2
ENST00000511038 ; TMEM144-006; intron 2
Clustered miRNAs
< 10kb from hsa-mir-3688-1
hsa-mir-3688-2chr4: 159128805-159128891 [+]
hsa-mir-3688-1chr4: 159128802-159128894 [-]
Database links

Mature sequence hsa-miR-3688-5p

Accession MIMAT0019223
Sequence

15 - 

aguggcaaagucuuuccauau

 - 35

Get sequence
Deep sequencing46 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-3688-3p

Accession MIMAT0018116
Previous IDshsa-miR-3688
Sequence

60 - 

uauggaaagacuuugccacucu

 - 81

Get sequence
Deep sequencing443 reads, 80 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).