Stem-loop sequence hsa-mir-3687-1

AccessionMI0016088 (change log)
Previous IDshsa-mir-3687
Symbol HGNC:MIR3687-1
DescriptionHomo sapiens miR-3687-1 stem-loop
Gene family MIPF0002051; mir-3687
Stem-loop
          g   c       -g c    ug   
5' cgcgcgu cgc cgagcgc  g ccgg  gu 
   ||||||| ||| |||||||  | ||||  | c
3' gugugca gcg gcuugcg  c ggcc  cc 
          -   u       ga a    cu   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-3687

Accession MIMAT0018115
Sequence

35 - 

cccggacaggcguucgugcgacgu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).