Stem-loop sequence hsa-mir-3686

AccessionMI0016087 (change log)
Symbol HGNC:MIR3686
DescriptionHomo sapiens miR-3686 stem-loop
Literature search

1 open access papers mention hsa-mir-3686
(1 sentences)

Stem-loop
           a         c                 u   ug 
5' cucaccuc uucauuuac uucucuuacagaucacu uuc  c
   |||||||| ||||||||| ||||||||||||||||| |||   
3' gaguggag aaguaaaug aagagaaugucuaguga agg  a
           a         a                 c   uc 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 129484057-129484142 [-]
sense
OTTHUMT00000381574 ; RP11-89M16.1-002; intron 1
ENST00000520766 ; RP11-89M16.1-002; intron 1
Database links

Mature sequence hsa-miR-3686

Accession MIMAT0018114
Sequence

55 - 

aucuguaagagaaaguaaauga

 - 76

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).