Stem-loop sequence hsa-mir-3685

AccessionMI0016086 (change log)
Symbol HGNC:MIR3685
DescriptionHomo sapiens miR-3685 stem-loop
Stem-loop
       a   -    -   ua  ug      uga 
5' guac uuu ccua ccc  cc  aagacu   g
   |||| ||| |||| |||  ||  ||||||   a
3' caug aaa gggu ggg  gg  uucuga   u
       -   c    a   --  gu      uau 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 95309923-95309984 [+]
antisense
OTTHUMT00000407530 ; NDUFA12-008; intron 1
OTTHUMT00000407531 ; NDUFA12-004; intron 4
ENST00000547447 ; NDUFA12-008; intron 1
ENST00000552205 ; NDUFA12-004; intron 4
Clustered miRNAs
< 10kb from hsa-mir-3685
hsa-mir-331chr12: 95308420-95308513 [+]
hsa-mir-3685chr12: 95309923-95309984 [+]
Database links

Mature sequence hsa-miR-3685

Accession MIMAT0018113
Sequence

6 - 

uuuccuacccuaccugaagacu

 - 27

Get sequence
Deep sequencing56 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).