Stem-loop sequence hsa-mir-3684

AccessionMI0016085 (change log)
Symbol HGNC:MIR3684
DescriptionHomo sapiens miR-3684 stem-loop
Stem-loop
               c                  uugag 
5' aaucuaaaggac uguacuagguuuaacaug     c
   |||||||||||| ||||||||||||||||||      
3' uuagauuuccug acaugauccagauuguac     a
               c                  ucauu 
Get sequence
Deep sequencing
131 reads, 0 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 98997387-98997460 [+]
antisense
OTTHUMT00000253642 ; STPG2-001; intron 5
ENST00000295268 ; STPG2-001; intron 5
Database links

Mature sequence hsa-miR-3684

Accession MIMAT0018112
Sequence

48 - 

uuagaccuaguacacguccuu

 - 68

Get sequence
Deep sequencing122 reads, 60 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).