Stem-loop sequence hsa-mir-3683

AccessionMI0016084 (change log)
Symbol HGNC:MIR3683
DescriptionHomo sapiens miR-3683 stem-loop
Literature search

1 open access papers mention hsa-mir-3683
(2 sentences)

Stem-loop
              cc   c  c    gaa        aucuc 
5' ggguguacacc  cug ga auug   guaguauc     u
   |||||||||||  ||| || ||||   ||||||||      
3' cccacaugugg  gac cu uaac   caucguag     c
              aa   a  a    aag        guucc 
Get sequence
Deep sequencing
109 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 7066964-7067045 [-]
intergenic
Database links

Mature sequence hsa-miR-3683

Accession MIMAT0018111
Sequence

15 - 

ugcgacauuggaaguaguauca

 - 36

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).