Stem-loop sequence hsa-mir-3682

AccessionMI0016083 (change log)
Symbol HGNC:MIR3682
DescriptionHomo sapiens miR-3682 stem-loop
Literature search

1 open access papers mention hsa-mir-3682
(1 sentences)

Stem-loop
               g                       a   a 
5' uaaguuauauau ucuacuucuaccuguguuaucau aua a
   |||||||||||| ||||||||||||||||||||||| |||  
3' auucaauauaua agauggagguggacauaguagua ugu g
               a                       c   g 
Get sequence
Deep sequencing
161 reads, 4.26 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 53849122-53849205 [-]
sense
OTTHUMT00000324162 ; ASB3-006; intron 8
ENST00000406053 ; GPR75-ASB3-006; intron 8
Database links

Mature sequence hsa-miR-3682-5p

Accession MIMAT0019222
Sequence

15 - 

cuacuucuaccuguguuaucau

 - 36

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3682-3p

Accession MIMAT0018110
Previous IDshsa-miR-3682
Sequence

50 - 

ugaugauacagguggagguag

 - 70

Get sequence
Deep sequencing150 reads, 44 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).