Stem-loop sequence hsa-mir-3681

AccessionMI0016082 (change log)
Symbol HGNC:MIR3681
DescriptionHomo sapiens miR-3681 stem-loop
Literature search

1 open access papers mention hsa-mir-3681
(13 sentences)

Stem-loop
                     u     c      g  c 
5' acuuccaguaguggauga gcacu ugugca gg c
   |||||||||||||||||| ||||| |||||| ||  
3' ugaaggucaucaccuacu cguga acacgu uc a
                     u     c      g  a 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 12199130-12199201 [+]
sense
OTTHUMT00000323602 ; AC096559.1-006; intron 2
OTTHUMT00000323599 ; AC096559.1-003; intron 2
OTTHUMT00000323583 ; AC096559.1-001; intron 2
OTTHUMT00000323601 ; AC096559.1-005; intron 2
ENST00000438292 ; AC096559.1-006; intron 2
ENST00000451644 ; AC096559.1-003; intron 2
ENST00000412294 ; AC096559.1-001; intron 2
ENST00000450916 ; AC096559.1-005; intron 2
Database links

Mature sequence hsa-miR-3681-5p

Accession MIMAT0018108
Previous IDshsa-miR-3681
Sequence

9 - 

uaguggaugaugcacucugugc

 - 30

Get sequence
Deep sequencing22 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-3681-3p

Accession MIMAT0018109
Previous IDshsa-miR-3681*
Sequence

45 - 

acacagugcuucauccacuacu

 - 66

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).