Stem-loop sequence hsa-mir-3678

AccessionMI0016079 (change log)
Symbol HGNC:MIR3678
DescriptionHomo sapiens miR-3678 stem-loop
Literature search

1 open access papers mention hsa-mir-3678
(1 sentences)

Stem-loop
                           u   uugaau   ug      uu 
5' gaauccgguccguacaaacucugc gug      gau  gugagu  g
   |||||||||||||||||||||||| |||      |||  ||||||   
3' cuuaggccaggcauguuugagacg cac      uua  uacucg  u
                           u   --uaag   gu      uu 
Get sequence
Deep sequencing
99 reads, 10.7 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 75406069-75406162 [+]
sense
OTTHUMT00000436353 ; SEPT9-010; intron 1
OTTHUMT00000436354 ; SEPT9-011; intron 1
OTTHUMT00000436345 ; SEPT9-016; intron 2
OTTHUMT00000436346 ; SEPT9-006; intron 2
OTTHUMT00000436662 ; SEPT9-038; intron 2
OTTHUMT00000438641 ; SEPT9-060; intron 2
OTTHUMT00000436351 ; SEPT9-008; intron 2
OTTHUMT00000436593 ; SEPT9-030; intron 2
OTTHUMT00000436352 ; SEPT9-009; intron 2
OTTHUMT00000436304 ; SEPT9-001; intron 3
OTTHUMT00000436310 ; SEPT9-004; intron 3
ENST00000592420 ; SEPT9-010; intron 1
ENST00000585930 ; SEPT9-011; intron 1
ENST00000591198 ; SEPT9-016; intron 2
ENST00000590294 ; SEPT9-006; intron 2
ENST00000588575 ; SEPT9-038; intron 2
ENST00000588690 ; SEPT9-060; intron 2
ENST00000423034 ; SEPT9-008; intron 2
ENST00000590059 ; SEPT9-030; intron 2
ENST00000427674 ; SEPT9-009; intron 2
ENST00000329047 ; SEPT9-201; intron 2
ENST00000427177 ; SEPT9-001; intron 3
ENST00000431235 ; SEPT9-004; intron 3
ENST00000449803 ; SEPT9-202; intron 3
Database links

Mature sequence hsa-miR-3678-5p

Accession MIMAT0018102
Sequence

9 - 

uccguacaaacucugcugug

 - 28

Get sequence
Deep sequencing16 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-3678-3p

Accession MIMAT0018103
Sequence

69 - 

cugcagaguuuguacggaccgg

 - 90

Get sequence
Deep sequencing77 reads, 15 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).