Stem-loop sequence hsa-mir-3677

AccessionMI0016078 (change log)
Symbol HGNC:MIR3677
DescriptionHomo sapiens miR-3677 stem-loop
Literature search

3 open access papers mention hsa-mir-3677
(4 sentences)

Stem-loop
      a             ------u  -a      
5' ggc guggccagagccc       gc  gugcu 
   ||| |||||||||||||       ||  |||| g
3' ccg caccggucucggg       cg  uacgg 
      g             ugcucuu  gg      
Get sequence
Deep sequencing
433 reads, 8.43 reads per million, 83 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 2270713-2270772 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3677
hsa-mir-3677chr16: 2270713-2270772 [+]
hsa-mir-940chr16: 2271747-2271840 [+]
hsa-mir-4717chr16: 2274620-2274691 [+]
Database links

Mature sequence hsa-miR-3677-5p

Accession MIMAT0019221
Sequence

3 - 

caguggccagagcccugcagug

 - 24

Get sequence
Deep sequencing160 reads, 49 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3677-3p

Accession MIMAT0018101
Previous IDshsa-miR-3677
Sequence

39 - 

cucgugggcucuggccacggcc

 - 60

Get sequence
Deep sequencing271 reads, 53 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).