Stem-loop sequence hsa-mir-3675

AccessionMI0016076 (change log)
Symbol HGNC:MIR3675
DescriptionHomo sapiens miR-3675 stem-loop
Literature search

2 open access papers mention hsa-mir-3675
(4 sentences)

Stem-loop
       gaua    a     --c    g       -   u 
5' ggau    aguu ugggg   uucu uagagau uuc a
   ||||    |||| |||||   |||| ||||||| ||| u
3' cuua    ucaa acccc   aagg aucucua aag g
       --ag    -     cuc    a       c   a 
Get sequence
Deep sequencing
53 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 16858949-16859021 [-]
intergenic
Database links

Mature sequence hsa-miR-3675-5p

Accession MIMAT0018098
Sequence

12 - 

uauggggcuucuguagagauuuc

 - 34

Get sequence
Deep sequencing33 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-3675-3p

Accession MIMAT0018099
Sequence

43 - 

caucucuaaggaacucccccaa

 - 64

Get sequence
Deep sequencing12 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).