Stem-loop sequence hsa-mir-3672

AccessionMI0016073 (change log)
Symbol HGNC:MIR3672
DescriptionHomo sapiens miR-3672 stem-loop
Stem-loop
               c           ug           agac 
5' ucuuugugauua caugagacuca  uaaaacaucuu    u
   |||||||||||| |||||||||||  |||||||||||     
3' agaaacacuaau guacucugagu  auuuuguagaa    a
               a           --           cauu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 121370972-121371053 [+]
intergenic
Database links

Mature sequence hsa-miR-3672

Accession MIMAT0018095
Sequence

15 - 

augagacucauguaaaacaucuu

 - 37

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).