Stem-loop sequence hsa-mir-3671

AccessionMI0016072 (change log)
Symbol HGNC:MIR3671
DescriptionHomo sapiens miR-3671 stem-loop
Stem-loop
   augu   ug    -u   -   acauuuac   a          u 
5'     uau  cugc  gcu guc        aug aaauaaaaug a
       |||  ||||  ||| |||        ||| |||||||||| a
3'     aua  gacg  uga cag        uau uuuauuuuau a
   ---u   gu    uc   u   gaauaaac   c          u 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 65057755-65057842 [-]
antisense
OTTHUMT00000025033 ; CACHD1-002; intron 2
OTTHUMT00000025238 ; CACHD1-001; intron 3
OTTHUMT00000025032 ; CACHD1-003; intron 3
ENST00000470527 ; CACHD1-002; intron 2
ENST00000290039 ; CACHD1-001; intron 3
ENST00000495994 ; CACHD1-003; intron 3
ENST00000371073 ; CACHD1-201; intron 3
Clustered miRNAs
< 10kb from hsa-mir-3671
hsa-mir-101-1chr1: 65058434-65058508 [-]
hsa-mir-3671chr1: 65057755-65057842 [-]
Database links

Mature sequence hsa-miR-3671

Accession MIMAT0018094
Sequence

60 - 

aucaaauaaggacuagucugca

 - 81

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).