Stem-loop sequence hsa-mir-3668

AccessionMI0016069 (change log)
Symbol HGNC:MIR3668
DescriptionHomo sapiens miR-3668 stem-loop
Literature search

2 open access papers mention hsa-mir-3668
(2 sentences)

Stem-loop
              -                  a    cu 
5' auauaugaaau guagagauugaucaaaau guuu  a
   ||||||||||| |||||||||||||||||| ||||   
3' uauauauuuua cgucucuaacuaguuuug uaaa  u
              a                  a    ac 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 140205252-140205326 [+]
intergenic
Database links

Mature sequence hsa-miR-3668

Accession MIMAT0018091
Sequence

9 - 

aauguagagauugaucaaaau

 - 29

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).