Stem-loop sequence hsa-mir-3667

AccessionMI0016068 (change log)
Symbol HGNC:MIR3667
DescriptionHomo sapiens miR-3667 stem-loop
Literature search

3 open access papers mention hsa-mir-3667
(5 sentences)

Stem-loop
   u                 u   ga         gcu 
5'  gaggaugaaagacccau gag  gaagguucu   g
    ||||||||||||||||| |||  |||||||||    
3'  cuccuacuuucugggua cuc  cuuccaaga   g
   a                 c   uc         guc 
Get sequence
Deep sequencing
197 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 49543393-49543466 [-]
intergenic
Database links

Mature sequence hsa-miR-3667-5p

Accession MIMAT0018089
Sequence

9 - 

aaagacccauugaggagaaggu

 - 30

Get sequence
Deep sequencing132 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-3667-3p

Accession MIMAT0018090
Sequence

45 - 

accuuccucuccaugggucuuu

 - 66

Get sequence
Deep sequencing53 reads, 36 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).