Stem-loop sequence hsa-mir-3666

AccessionMI0016067 (change log)
Symbol HGNC:MIR3666
DescriptionHomo sapiens miR-3666 stem-loop
Literature search

4 open access papers mention hsa-mir-3666
(9 sentences)

Stem-loop
   aguaa    --cg     --u  a  -      c  u   a    -      -c     cg 
5'      gguc    ucagu   gu au gagacc ag gca gugu agaugc  gacuc  u
        ||||    |||||   || || |||||| || ||| |||| ||||||  |||||  g
3'      uuag    aguua   ca ug cucugg uc cgu caca uuugcg  uugag  g
   ----g    auua     ucu  c  u      -  -   -    c      ac     ac 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was predicted as a miRNA by Xie et al. [1] and validated later by microarray [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 114653345-114653455 [+]
sense
OTTHUMT00000140191 ; MDFIC-005; intron 3
OTTHUMT00000351028 ; MDFIC-006; intron 3
OTTHUMT00000059968 ; MDFIC-001; intron 4
OTTHUMT00000366397 ; MDFIC-007; intron 4
ENST00000431629 ; MDFIC-005; intron 3
ENST00000498196 ; MDFIC-006; intron 3
ENST00000393486 ; MDFIC-001; intron 4
ENST00000257724 ; MDFIC-007; intron 4
Database links

Mature sequence hsa-miR-3666

Accession MIMAT0018088
Sequence

29 - 

cagugcaaguguagaugccga

 - 49

Get sequence
Evidence experimental; microarray [1]
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:20559549 "Large-scale expression analysis reveals distinct microRNA profiles at different stages of human neurodevelopment" Smith B, Treadwell J, Zhang D, Ly D, McKinnell I, Walker PR, Sikorska M PLoS One. 5:e11109(2010).