Stem-loop sequence hsa-mir-3664

AccessionMI0016065 (change log)
Symbol HGNC:MIR3664
DescriptionHomo sapiens miR-3664 stem-loop
Gene family MIPF0001518; mir-3664
Stem-loop
   cuguaa  -                       c    a    uac   cc 
5'       ac uugaagguagggaacucugucuu acuc ugag   cuu  a
         || ||||||||||||||||||||||| |||| ||||   |||  a
3'       ug aacuuccaucccuugagacagaa ugag acuc   gag  c
   --uagg  u                       a    g    -uc   ca 
Get sequence
Deep sequencing
1213 reads, 0.962 reads per million, 104 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 70872270-70872368 [-]
sense
OTTHUMT00000259336 ; SHANK2-010; intron 3
ENST00000413503 ; SHANK2-010; intron 3
Database links

Mature sequence hsa-miR-3664-5p

Accession MIMAT0018086
Previous IDshsa-miR-3664
Sequence

21 - 

aacucugucuucacucaugagu

 - 42

Get sequence
Deep sequencing108 reads, 40 experiments
Evidence experimental; Northern [1], Illumina [2]
Predicted targets

Mature sequence hsa-miR-3664-3p

Accession MIMAT0019220
Sequence

59 - 

ucucaggaguaaagacagaguu

 - 80

Get sequence
Deep sequencing895 reads, 102 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).