Stem-loop sequence hsa-mir-3663

AccessionMI0016064 (change log)
Symbol HGNC:MIR3663
DescriptionHomo sapiens miR-3663 stem-loop
Literature search

4 open access papers mention hsa-mir-3663
(6 sentences)

Stem-loop
   ---   ggga         a      -      c             -   u 
5'    ccc    ccuuggucc ggcgcu ggucug guggugcucgggu gga a
      |||    ||||||||| |||||| |||||| ||||||||||||| |||  
3'    ggg    ggaaccagg ccgcgg ccggac caccacgagucua ucu a
   cuc   ----         g      g      a             g   g 
Get sequence
Deep sequencing
185 reads, 38.5 reads per million, 52 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 117167678-117167774 [-]
antisense
OTTHUMT00000384501 ; ATRNL1-011; intron 3
OTTHUMT00000384500 ; ATRNL1-010; intron 4
OTTHUMT00000050507 ; ATRNL1-001; intron 20
ENST00000534530 ; ATRNL1-011; intron 3
ENST00000303745 ; ATRNL1-201; intron 3
ENST00000526373 ; ATRNL1-010; intron 4
ENST00000423111 ; ATRNL1-202; intron 4
ENST00000355044 ; ATRNL1-001; intron 20
Database links

Mature sequence hsa-miR-3663-5p

Accession MIMAT0018084
Sequence

21 - 

gcuggucugcguggugcucgg

 - 41

Get sequence
Deep sequencing34 reads, 13 experiments
Evidence experimental; Northern [1]
Predicted targets

Mature sequence hsa-miR-3663-3p

Accession MIMAT0018085
Sequence

58 - 

ugagcaccacacaggccgggcgc

 - 80

Get sequence
Deep sequencing70 reads, 23 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2