Stem-loop sequence hsa-mir-3662

AccessionMI0016063 (change log)
Symbol HGNC:MIR3662
DescriptionHomo sapiens miR-3662 stem-loop
Literature search

2 open access papers mention hsa-mir-3662
(2 sentences)

Stem-loop
   ----------      uuccucaacgc   -       -    c   c c     cca 
5'           uguguu           uca caguuac acuu uua u ucaau   u
             ||||||           ||| ||||||| |||| ||| | |||||    
3'           acacga           agu gucagug ugag agu a aguua   u
   aaccgacuaa      -----------   a       a    u   a a     uac 
Get sequence
Deep sequencing
810 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 134979338-134979432 [-]
sense
OTTHUMT00000042331 ; RP11-557H15.4-003; intron 1
ENST00000434593 ; RP11-557H15.4-003; intron 1
Database links

Mature sequence hsa-miR-3662

Accession MIMAT0018083
Sequence

55 - 

gaaaaugaugaguagugacugaug

 - 78

Get sequence
Deep sequencing804 reads, 37 experiments
Evidence experimental; Northern [1]
Database links
Predicted targets

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).