Stem-loop sequence hsa-mir-3661

AccessionMI0016062 (change log)
Symbol HGNC:MIR3661
DescriptionHomo sapiens miR-3661 stem-loop
Gene family MIPF0001530; mir-3661
Literature search

3 open access papers mention hsa-mir-3661
(4 sentences)

Stem-loop
   caccuuc    a    cu  u    -ug   c   ga      cuu  a 
5'        ucgc gagg  cu gacc   gga ucg  cagcug   gc c
          |||| ||||  || ||||   ||| |||  ||||||   ||  
3'        agug uucc  ga cugg   ccu agc  gucgac   ug u
   uuccaca    g    uc  c    uca   -   uc      --u  c 
Get sequence
Deep sequencing
182 reads, 5.26 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 134225757-134225852 [+]
sense
OTTHUMT00000371552 ; TXNDC15-002; intron 1
OTTHUMT00000371560 ; TXNDC15-010; intron 1
OTTHUMT00000251160 ; TXNDC15-001; intron 2
OTTHUMT00000371555 ; TXNDC15-005; intron 2
OTTHUMT00000371554 ; TXNDC15-004; intron 2
ENST00000511070 ; TXNDC15-002; intron 1
ENST00000506350 ; TXNDC15-010; intron 1
ENST00000358387 ; TXNDC15-001; intron 2
ENST00000507024 ; TXNDC15-005; intron 2
ENST00000508779 ; TXNDC15-004; intron 2
ENST00000546290 ; TXNDC15-201; intron 2
Database links

Mature sequence hsa-miR-3661

Accession MIMAT0018082
Sequence

21 - 

ugaccugggacucggacagcug

 - 42

Get sequence
Deep sequencing167 reads, 50 experiments
Evidence experimental; Northern [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).