Stem-loop sequence hsa-mir-3659

AccessionMI0016060 (change log)
Symbol HGNC:MIR3659
DescriptionHomo sapiens miR-3659 stem-loop
Stem-loop
   uc    a                       c       a    -   cu 
5'   uaca gcagauacaaggaugcccuugua acaacac cgug cug  u
     |||| ||||||||||||||||||||||| ||||||| |||| |||   
3'   gugu ugucuguguuccuacgggagcau uguugug guac gau  g
   gu    g                       c       a    a   au 
Get sequence
Deep sequencing
293 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 38089231-38089329 [+]
antisense
OTTHUMT00000012475 ; RSPO1-001; intron 3
OTTHUMT00000280560 ; RSPO1-004; intron 3
OTTHUMT00000012477 ; RSPO1-003; intron 3
OTTHUMT00000012476 ; RSPO1-002; intron 4
ENST00000373059 ; RSPO1-001; intron 3
ENST00000401070 ; RSPO1-004; intron 3
ENST00000401069 ; RSPO1-003; intron 3
ENST00000401071 ; RSPO1-202; intron 3
ENST00000401068 ; RSPO1-002; intron 4
ENST00000356545 ; RSPO1-201; intron 4
Database links

Mature sequence hsa-miR-3659

Accession MIMAT0018080
Sequence

59 - 

ugaguguugucuacgagggca

 - 79

Get sequence
Deep sequencing263 reads, 48 experiments
Evidence experimental; Northern [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).