Stem-loop sequence hsa-mir-3657

AccessionMI0016057 (change log)
Symbol HGNC:MIR3657
DescriptionHomo sapiens miR-3657 stem-loop
Stem-loop
          ca      a   a                              --      g 
5' ugugucc  uaauua aua ugaaaucugaaaucaccaauaaugggacac  uaaugu a
   |||||||  |||||| ||| ||||||||||||||||||||||||||||||  |||||| u
3' auacagg  auuagu uau acuuuagacuuuagugguuauuacccugug  guugua u
          -a      a   -                              uu      a 
Get sequence
Deep sequencing
569 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 112037599-112037715 [-]
antisense
OTTHUMT00000404992 ; RP11-686G8.2-001; exon 2
ENST00000547021 ; RP11-686G8.2-001; exon 2
Database links

Mature sequence hsa-miR-3657

Accession MIMAT0018077
Sequence

69 - 

ugugucccauuauuggugauu

 - 89

Get sequence
Deep sequencing402 reads, 32 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).