Stem-loop sequence hsa-mir-3655

AccessionMI0016055 (change log)
Symbol HGNC:MIR3655
DescriptionHomo sapiens miR-3655 stem-loop
Stem-loop
      - g     g       gc     ga ac  ga      g 
5' gcu u ucgcu cgguguu  uguug  g  uc  uuguug u
   ||| | ||||| |||||||  |||||  |  ||  ||||||  
3' uga a agcga gccguaa  acaau  c  ag  agcgac g
      u g     g       -a     ag -a  aa      a 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 140647844-140647926 [+]
intergenic
Database links

Mature sequence hsa-miR-3655

Accession MIMAT0018075
Sequence

1 - 

gcuugucgcugcgguguugcu

 - 21

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).