Stem-loop sequence hsa-mir-3653

AccessionMI0016053 (change log)
Symbol HGNC:MIR3653
DescriptionHomo sapiens miR-3653 stem-loop
Stem-loop
      c      ccccu          c ugaugauu      ccu   cac     ugaug 
5' ucc ugggga     ggcagccccu c        cuucuu   gag   gcuca     a
   ||| ||||||     |||||||||| |        ||||||   |||   |||||      
3' agg accccu     ucgucgggga g        gaagaa   cuc   cgagu     g
      a      -----          a --ucaguu      --u   ---     caaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-3653-5p

Accession MIMAT0032110
Sequence

23 - 

ccuccugaugauucuucuuc

 - 42

Get sequence
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-3653-3p

Accession MIMAT0018073
Previous IDshsa-miR-3653
Sequence

75 - 

cuaagaaguugacugaag

 - 92

Get sequence
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).