Stem-loop sequence hsa-mir-3648-1

AccessionMI0016048 (change log)
Previous IDshsa-mir-3648
Symbol HGNC:MIR3648-1
DescriptionHomo sapiens miR-3648-1 stem-loop
Gene family MIPF0001984; mir-3648
Literature search

14 open access papers mention hsa-mir-3648-1
(91 sentences)

Stem-loop
        ---cu     -     u  u     ga            g  ga    -           -c     -   -       u   --    g 
5' cgcga     gcggc ggcgg gg ggggg  gccgcggggauc cc  gggc cggucggccgc  ccggg ugc cgcgcgg gcc  gccg c
   |||||     ||||| ||||| || |||||  |||||||||||| ||  |||| |||||||||||  ||||| ||| ||||||| |||  ||||  
3' gcgcu     cgccg ccgcc cc ucccc  cggugccccugg gg  cucg gccggcuggcg  ggccc gug gcgcgcc cgg  uggc g
        cuuuc     g     -  u     ug            -  ag    c           uc     u   u       c   ag    g 
Get sequence
Deep sequencing
4604 reads, 8.61 reads per million, 151 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 8208473-8208652 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3648-1
hsa-mir-6724-1chr21: 8205315-8205406 [+]
hsa-mir-10401chr21: 8206563-8206618 [+]
hsa-mir-3648-1chr21: 8208473-8208652 [+]
hsa-mir-10401chr21: 8250772-8250827 [+]
hsa-mir-10401chr21: 8389610-8389665 [+]
hsa-mir-10401chr21: 8433797-8433852 [+]
Database links

Mature sequence hsa-miR-3648

Accession MIMAT0018068
Sequence

28 - 

agccgcggggaucgccgaggg

 - 48

Get sequence
Deep sequencing3216 reads, 102 experiments
Evidence experimental; 454 [1]

References

1
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).