Stem-loop sequence hsa-mir-3620

AccessionMI0016011 (change log)
Symbol HGNC:MIR3620
DescriptionHomo sapiens miR-3620 stem-loop
Literature search

3 open access papers mention hsa-mir-3620
(4 sentences)

Stem-loop
   g  a    g   cca      agugggcugggcugggcu 
5'  ug ggug ggg   gcaggg                  g
    || |||| |||   ||||||                  g
3'  ac ccac ccc   cguccc                  g
   g  -    g   -ua      acuccggaacauggaacc 
Get sequence
Deep sequencing
654 reads, 0 reads per million, 88 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 228097263-228097341 [+]
intergenic
Database links

Mature sequence hsa-miR-3620-5p

Accession MIMAT0022967
Sequence

23 - 

gugggcugggcugggcugggcc

 - 44

Get sequence
Deep sequencing383 reads, 81 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-3620-3p

Accession MIMAT0018001
Previous IDshsa-miR-3620
Sequence

58 - 

ucacccugcaucccgcacccag

 - 79

Get sequence
Deep sequencing256 reads, 43 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1