Stem-loop sequence hsa-mir-3619

AccessionMI0016009 (change log)
Symbol HGNC:MIR3619
DescriptionHomo sapiens miR-3619 stem-loop
Literature search

5 open access papers mention hsa-mir-3619
(8 sentences)

Stem-loop
        -a       -a u           c    g ag   g 
5' acggc  ucuuugc  c cagcaggcagg uggu c  ccc u
   |||||  |||||||  | ||||||||||| |||| |  ||| g
3' ugucg  aggaaug  g gucguccgucc acca g  ggg g
        gc       gg u           u    g --   u 
Get sequence
Deep sequencing
210 reads, 2.78 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 46091044-46091126 [+]
sense
OTTHUMT00000318142 ; ATXN10-001; intron 3
OTTHUMT00000322278 ; ATXN10-002; intron 3
OTTHUMT00000322279 ; ATXN10-003; intron 3
ENST00000381061 ; ATXN10-201; intron 2
ENST00000252934 ; ATXN10-001; intron 3
ENST00000498009 ; ATXN10-002; intron 3
ENST00000470722 ; ATXN10-003; intron 3
Database links

Mature sequence hsa-miR-3619-5p

Accession MIMAT0017999
Previous IDshsa-miR-3619
Sequence

16 - 

ucagcaggcaggcuggugcagc

 - 37

Get sequence
Deep sequencing151 reads, 56 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence hsa-miR-3619-3p

Accession MIMAT0019219
Sequence

47 - 

gggaccauccugccugcugugg

 - 68

Get sequence
Deep sequencing58 reads, 30 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).