Stem-loop sequence hsa-mir-3618

AccessionMI0016008 (change log)
Symbol HGNC:MIR3618
DescriptionHomo sapiens miR-3618 stem-loop
Gene family MIPF0001710; mir-3618
Literature search

3 open access papers mention hsa-mir-3618
(7 sentences)

Stem-loop
          ag        ga   c  a    ug       gguu 
5' uaagcug  ugcauugu  uuu ca uaau  aggcagu    c
   |||||||  ||||||||  ||| || ||||  |||||||     
3' guucgac  guguaacg  aaa gu auua  ucugucg    u
          cg        ag   a  a    ca       aaaa 
Get sequence
Deep sequencing
56 reads, 8 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 20085746-20085833 [+]
sense
OTTHUMT00000318660 ; DGCR8-007; intron 1
OTTHUMT00000318657 ; DGCR8-004; intron 6
OTTHUMT00000318655 ; DGCR8-002; intron 7
OTTHUMT00000318656 ; DGCR8-003; intron 7
OTTHUMT00000318654 ; DGCR8-001; intron 9
ENST00000491892 ; DGCR8-007; intron 1
ENST00000498171 ; DGCR8-004; intron 6
ENST00000495826 ; DGCR8-002; intron 7
ENST00000407755 ; DGCR8-003; intron 7
ENST00000383024 ; DGCR8-201; intron 8
ENST00000351989 ; DGCR8-001; intron 9
Clustered miRNAs
< 10kb from hsa-mir-3618
hsa-mir-3618chr22: 20085746-20085833 [+]
hsa-mir-1306chr22: 20086058-20086142 [+]
Database links

Mature sequence hsa-miR-3618

Accession MIMAT0017998
Sequence

52 - 

ugucuacauuaaugaaaagagc

 - 73

Get sequence
Deep sequencing33 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1