Stem-loop sequence hsa-mir-3617

AccessionMI0016007 (change log)
Symbol HGNC:MIR3617
DescriptionHomo sapiens miR-3617 stem-loop
Gene family MIPF0001477; mir-3617
Literature search

1 open access papers mention hsa-mir-3617
(6 sentences)

Stem-loop
      u  u      -      -u   aa        uagaa 
5' agg ca agaaag acauag  ugc  gaugggau     a
   ||| || |||||| ||||||  |||  ||||||||      
3' ucc gu ucuuuc uguauc  acg  cuacucug     c
      c  c      c      cc   -a        uauac 
Get sequence
Deep sequencing
574 reads, 0 reads per million, 97 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 45705102-45705180 [-]
antisense
OTTHUMT00000080325 ; EYA2-004; intron 3
OTTHUMT00000354590 ; EYA2-009; intron 6
OTTHUMT00000080326 ; EYA2-005; intron 7
OTTHUMT00000354589 ; EYA2-008; intron 7
OTTHUMT00000080324 ; EYA2-003; intron 7
ENST00000458636 ; EYA2-004; intron 3
ENST00000317304 ; EYA2-009; intron 6
ENST00000327619 ; EYA2-005; intron 7
ENST00000357410 ; EYA2-008; intron 7
ENST00000497062 ; EYA2-003; intron 7
Database links

Mature sequence hsa-miR-3617-5p

Accession MIMAT0017997
Previous IDshsa-miR-3617
Sequence

10 - 

aaagacauaguugcaagauggg

 - 31

Get sequence
Deep sequencing510 reads, 92 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence hsa-miR-3617-3p

Accession MIMAT0022966
Sequence

50 - 

caucagcacccuauguccuuucu

 - 72

Get sequence
Deep sequencing63 reads, 34 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).